Review




Structured Review

Cell Biolabs Inc oxiselect comet assay kit sta-351
Oxiselect Comet Assay Kit Sta 351, supplied by Cell Biolabs Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/oxiselect+comet+assay+kit+sta-351/oxiselect+comet+assay+kit/bio_rxiv__2025__07__10__663928-269-8-5
Average 90 stars, based on 1 article reviews
oxiselect comet assay kit sta-351 - by Bioz Stars, 2026-09
90/100 stars

Images

Related Articles

Single Cell Gel Electrophoresis:

Article Title: PARP1 promotes replication-independent DNA double-strand break formation after acute DNA-methylation damage
Article Snippet: .. COMET assays were performed using Cell Biolabs Inc OxiSelect COMET Assay Kit (STA-351) following the manufacturer’s protocols. .. COMET assays were performed using Cell Biolabs Inc OxiSelect COMET Assay Kit (STA-351) following the manufacturer’s protocols.

Article Title: Aicardi-Goutières syndrome-associated gene SAMHD1 preserves genome integrity by preventing R-loop formation at transcription–replication conflict regions
Article Snippet: .. At 48 hours post-transfection, an alkaline assay was performed on U2OS cells using an OxiSelect Comet Assay kit (CELL BIOLABS, STA-351) according to the manufacturer’s instructions. ..

Article Title: <i>SETD2</i> Deficiency Confers Sensitivity to Dual Inhibition of DNA Methylation and PARP in Kidney Cancer
Article Snippet: .. DNA damage in SETD2-WT or KO ccRCC cells were detected by alkaline comet assay using the OxiSelect Comet Assay Kit (Cell Biolabs, STA-351) according to the manufacturer’s instructions. .. A Zeiss Axio Scope A1 (Carl Zeiss) microscope equipped with a 10 objective was used to visualize cells.

Article Title: TEAD Proteins Associate With DNA Repair Proteins to Facilitate Cellular Recovery From DNA Damage.
Article Snippet: .. The Comet assay was performed using OxiSelect comet assay kit (STA-351, Cell Biolabs, Inc.) following manufacturer’s instructions. ..

Article Title: Towards precision radiation oncology: endocrine therapy response as a biomarker for personalization of breast radiotherapy.
Article Snippet: .. 30 minutes after IR treatment, cells were harvested, resuspended in ice-cold PBS (without Mg2+ and Ca2+) and subjected to comet assay (OxiSelect Comet Assay kit, STA-351, Cell Biolabs, Inc) using single-cell agarose gel electrophoresis under alkaline conditions following the manufacturer’s protocol. ..

other:

Article Title: GamaComet: A Deep Learning-Based Tool for the Detection and Classification of DNA Damage from Buccal Mucosa Comet Assay Images
Article Snippet: The comet assay was performed using an Oxiselect Comet Assay Kit STA-351 (Cell Biolabs, San Diego, CA, USA) with a modified protocol [ ].

Article Title: Development of an orally bioavailable CDK12/13 degrader and induction of synthetic lethality with AKT pathway inhibition.
Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER ATR_Rev: CAATTAGTGCCTGGTGAACATC Quereda, V. et al.16 N/A BRCA1_Fwd: CTGCTCAGGGCTATCCTCTCA Quereda, V. et al.16 N/A BRCA1_Rev: GCTTCTAGTTCAGCCATTTCCTG Quereda, V. et al.16 N/A CDK12_Fwd: CCAATCTGGAACTGGCTCAG Quereda, V. et al.16 N/A CDK12_Rev: CAAGTGCTGCAGAAGGAATG Quereda, V. et al.16 N/A CDK13_Fwd: GGTGTTTGAATATATGGACC Quereda, V. et al.16 N/A CDK13_Rev: CAAGTCCAAAGTCTGCAAGTT Quereda, V. et al.16 N/A Software and algorithms PRISM GraphPad Software Version 10 ImageJ NIH https://imagej.nih.gov/ij/ ImageStudio Lite Li-Cor Ver5.2 Pymol Schrödinger https://www.schrodinger.com/products/pymol Maestro Schrödinger Version 9.9 FlowJo FlowJo Software Version 10.8.2 SynergyFinder Oxford Academic https://synergyfinder.fimm.fi/synergy e3 Cell Reports Medicine 5, 101752, October 15, 2024 OPEN ACCESS was used to prepare the proteins, which included adding bond orders and hydrogens and removing water molecules.

Article Title: Discovery of YJZ5118 : A Potent and Highly Selective Irreversible CDK12/13 Inhibitor with Synergistic Effects in Combination with Akt Inhibition.
Article Snippet: Cyclin-dependent kinases 12 and 13 (CDK12/13) have emerged as promising therapeutic targets for castrationresistant prostate cancer (CRPC) and other human cancers.. Despite the development of several CDK12/13 inhibitors, challenges remain in achieving an optimal balance of potency, selectivity and pharmacokinetic properties.. Here, we report the discovery of YJZ5118, a novel, potent and highly selective covalent inhibitor of CDK12/13 with reasonable pharmacokinetic profiles.

Alkaline Single Cell Gel Electrophoresis:

Article Title: <i>SETD2</i> Deficiency Confers Sensitivity to Dual Inhibition of DNA Methylation and PARP in Kidney Cancer
Article Snippet: .. DNA damage in SETD2-WT or KO ccRCC cells were detected by alkaline comet assay using the OxiSelect Comet Assay Kit (Cell Biolabs, STA-351) according to the manufacturer’s instructions. .. A Zeiss Axio Scope A1 (Carl Zeiss) microscope equipped with a 10 objective was used to visualize cells.

Single Cell:

Article Title: Towards precision radiation oncology: endocrine therapy response as a biomarker for personalization of breast radiotherapy.
Article Snippet: .. 30 minutes after IR treatment, cells were harvested, resuspended in ice-cold PBS (without Mg2+ and Ca2+) and subjected to comet assay (OxiSelect Comet Assay kit, STA-351, Cell Biolabs, Inc) using single-cell agarose gel electrophoresis under alkaline conditions following the manufacturer’s protocol. ..

Agarose Gel Electrophoresis:

Article Title: Towards precision radiation oncology: endocrine therapy response as a biomarker for personalization of breast radiotherapy.
Article Snippet: .. 30 minutes after IR treatment, cells were harvested, resuspended in ice-cold PBS (without Mg2+ and Ca2+) and subjected to comet assay (OxiSelect Comet Assay kit, STA-351, Cell Biolabs, Inc) using single-cell agarose gel electrophoresis under alkaline conditions following the manufacturer’s protocol. ..



Similar Products

90
Cell Biolabs Inc oxiselect comet assay kit sta-351
Oxiselect Comet Assay Kit Sta 351, supplied by Cell Biolabs Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/oxiselect+comet+assay+kit+sta-351/oxiselect+comet+assay+kit/bio_rxiv__2025__07__10__663928-269-8-5
Average 90 stars, based on 1 article reviews
oxiselect comet assay kit sta-351 - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

90
Cell Biolabs Inc oxiselect comet assay kit (3-well slides) sta-351
Oxiselect Comet Assay Kit (3 Well Slides) Sta 351, supplied by Cell Biolabs Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/oxiselect+comet+assay+kit+sta-351/oxiselect+comet+assay+kit/pm36709426-326-17-9
Average 90 stars, based on 1 article reviews
oxiselect comet assay kit (3-well slides) sta-351 - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

90
Cell Biolabs Inc oxiselect™ comet assay kit (3-well slides) (sta-351)
Oxiselect™ Comet Assay Kit (3 Well Slides) (Sta 351), supplied by Cell Biolabs Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/oxiselect+comet+assay+kit+sta-351/oxiselect+comet+assay+kit/10__1007_slash_s42242___022___00198___z-44-29-37
Average 90 stars, based on 1 article reviews
oxiselect™ comet assay kit (3-well slides) (sta-351) - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

Image Search Results